Primary hyperparathyroidism with PTH values within the reference range: clinical case of a patient with recurrent nephrolithiasis

Cover Page

Abstract


Hyperparathyroidism is an endocrine disease characterized by excessive secretion of parathyroid hormone (PTH) by the parathyroid glands. Primary hyperparathyroidism (PHPT) can be diagnosed biochemically with the combination of hypercalcemia and upper-normal or elevated levels of PTH. There are few descriptions of PHPT with normal intact PTH secretion in the literature. The incidence of PHPT among patients with recurrent urolithiasis is 2–8%. We present a clinical case of diagnosing PHPT in a 64-year-old female patient with rare variant of the disease. Before establishing the diagnosis, the main patient complaints were long-term recurrent nephrolithiasis and nephrocalcinosis. Surgical treatment made it possible to achieve rapid normalization of biochemical parameters of calcium-phosphorus metabolism, increase bone mineral density in the lumbar spine, improve the general condition of the patient. This clinical case demonstrates errors and late diagnosis of PHPT associated with poor knowledge of the manifestations of hyperparathyroidism and its masks. The authors recommend to determine the concentrations of total calcium, albumin, serum levels of PTH in patients with clinical picture of PHPT, in order to exclude the disease.


АКТУАЛЬНОСТЬ

Гиперпаратиреоз – эндокринное заболевание, возникающее в результате автономной продукции паратиреоидного гормона (ПТГ), обусловленной первичным поражением околощитовидных желез (ОЩЖ) [1].

При первичном гиперпаратиреозе (ПГПТ) повышение секреции ПТГ происходит в результате аденомы либо гиперплазии одной или нескольких ОЩЖ. Поскольку ведущий биохимический признак ПГПТ – гиперкальциемия, при проведении диагностического поиска следует иметь в виду и другие, довольно многочисленные причины этого состояния.

Исследование уровня ПТГ необходимо проводить при выявлении отклонений от нормы содержания кальция и фосфора сыворотки крови, различных нарушений со стороны опорно-двигательного аппарата, хронической болезни почек (ХБП), рецидивирующей мочекаменной болезни, язвенной болезни желудка и двенадцатиперстной кишки, изменений состояния сердечно-сосудистой системы. В настоящее время ПТГ крови возможно исследовать различными высокочувствительными методами, но наиболее приемлемы те из них, в которых определяется интактный ПТГ (иПТГ), являющийся основным продуктом секреции клеток ОЩЖ.

Согласно клиническим рекомендациям по диагностике и лечению ПГПТ [1], верхненормальный либо повышенный уровень ПТГ в сочетании с гиперкальциемией позволяют диагностировать ПГПТ. В литературе встречаются единичные описания случаев сочетания гиперкальциемии с нормальной секрецией иПТГ. Представленный нами клинический случай демонстрирует один из редких вариантов течения ПГПТ.

ОПИСАНИЕ СЛУЧАЯ

Пациентка А., 64 лет, поступила в Клинику эндокринологии Первого МГМУ им. И.М. Сеченова (далее – Сеченовский Университет) с жалобами на выраженную общую и мышечную слабость, быструю утомляемость, постепенное снижение массы тела на 17 кг, давящие боли в области сердца, купирующиеся нитроглицерином, ощущение «онемения и покалывания» в руках и ногах.

Объективно: рост 156 см, вес 65 кг, ИМТ = 23,3 кг/м2. Наследственность не отягощена.

Из анамнеза известно, что в течение 28 лет страдает мочекаменной болезнью. За это время конкременты многократно отходили самостоятельно. Перенесла пиелолитотомию и нефропексию справа, уретеролитотомию слева, несколько эпизодов почечной колики. В 2017 г. в Клинике урологии Сеченовского Университета выполнены чрескожная нефролитолапаксия, нефростомия слева. Учитывая рецидивирующее течение мочекаменной болезни, проведен комплекс лабораторных исследований, данные которого представлены в таблице 1.

 

Таблица 1. Данные лабораторного исследования в Клинике урологии в мае 2017 г.

Параметр

Значение

Референсный интервал

Кальций общий, ммоль/л

2,68

2,08–2,65

Кальций ионизированный, ммоль/л

1,46

1,12–1,32

Фосфор, ммоль/л

1,01

0,78–1,65

Щелочная фосфатаза, Ед/л

326

70–360

Паратгормон, пмоль/л

9,5

1,3–6,8

 

В возрасте 40 лет пациентке была выполнена субтотальная гистерэктомия по поводу миомы с удалением левого яичника. В 2010 г. диагностирована язвенная болезнь двенадцатиперстной кишки. С 2014 г. отмечает эпизоды повышения артериального давления до 180/100 мм рт.ст., в связи с чем регулярно принимает антигипертензивную терапию.

При поступлении в Клинику эндокринологии был заподозрен ПГПТ, проведены лабораторно-инструментальные исследования (табл. 2). При обследовании была выявлена гиперкальциемия (кальций общий 2,98 ммоль/л; кальций, скорректированный на альбумин, 3,03 ммоль/л), уровень ПТГ в пределах референсных значений. В клиническом анализе крови СОЭ увеличена до 39 мм/ч (по Панченкову), остальные показатели в пределах референсных значений.

В анализе суточной мочи отмечается гиперкальциурия (экскреция кальция 13,38 ммоль/сут), экскреция фосфора в пределах референсных значений.

 

Таблица 2. Показатели лабораторного исследования при первичном обращении

Параметр

Значение

Референсный интервал

Кальций общий, ммоль/л

2,98

2,08–2,65

Кальций ионизированный, ммоль/л

1,65

1,12–1,32

Альбумин, г/л

37,4

32–48

Кальций, скорректированный на альбумин, ммоль/л

3,03

 

Фосфор, ммоль/л

1,10

0,78–1,65

Паратгормон интактный, пмоль/л

5,6

1,3–6,8

Тиреотропный гормон (ТТГ), мкМЕ/мл

0,7

0,4–4

Креатинин, мг/дл

1,02

0,5–1,3

Скорость клубочковой фильтрации (СКФ), мл/мин/1,73м2

58

90–120

25(ОН)D, нг/мл

30,7

>30

 

Учитывая нормальный уровень иПТГ, выполнено повторное исследование в лаборатории Клиники эндокринологии и в сторонней лаборатории. Также с целью исключения феномена hook-эффекта проведено исследование иПТГ с разведением. Полученные результаты представлены в таблице 3. В трех измерениях концентрация иПТГ превышает верхнюю границу референсного интервала, однако повышение незначимо и не соответствует выраженной гиперкальциемии и гиперкальциурии. Молекулярно-генетический анализ не выявил инактивирующей мутации в гене кальций-чувствительных рецепторов (CаSR) в почках и ОЩЖ. Употребление продуктов с высоким содержанием кальция, а также прием препаратов витамина D пациентка отрицала.

 

Таблица 3. Динамика иПТГ пациентки А.

иПТГ

Значение

Референсный интервал

При поступлении в стационар

9,5 пмоль/л

1,3–6,8

На 8-сутки госпитализации

5,6 пмоль/л

1,3–6,8

На 10-е сутки госпитализации

5,1 пмоль/л

1,3–6,8

На 16-е сутки госпитализации, сторонняя лаборатория

81,76 пг/мл

15–65

иПТГ с разведением

7,3 пмоль/л

1,3–6,8

иПТГ исследовался автоматической иммунохемилюминесцентной системой IMMULITE 2000 XPi.

 

При ультразвуковом исследовании (УЗИ) околощитовидные железы не визуализируются. Выявлены признаки диффузно-мелкоочаговых изменений щитовидной железы (ЩЖ). При сцинтиграфии с технетрилом (99mTс-MIBI) в сочетании с однофотонной эмиссионной компьютерной томографией (ОФЭКТ) обнаружен очаг аномального накопления умеренной интенсивности, расположенный за левой долей ЩЖ на уровне ее нижнего полюса, пространственно от нее сепарируемый, что указывает на признаки новообразования левой нижней ОЩЖ.

По результатам двухэнергетической рентгеновской абсорбциометрии (DXA) минеральная плотность костной ткани в проксимальном отделе бедренной кости по Т-критерию составила -1 SD, в поясничном отделе позвоночника (LI–LIV) – -3,0 SD.

На основании гиперкальциемии при нормальном иПТГ, повышения СОЭ в общем анализе крови, снижения массы тела в анамнезе проведены дополнительные обследования, позволившие исключить миеломную болезнь. Онкомаркеры, в том числе СА 19-9, СА-15-3, СА-125, раковоэмбриональный антиген, в пределах референсных значений.

Учитывая рецидивирующий нефролитиаз, нефрокальциноз, снижение СКФ до ХБП С3, язвенную болезнь в анамнезе, остеопороз по данным DXA, неоднократно подтвержденную гиперкальциемию, гиперкальциурию, несмотря на нормальный уровень иПТГ, диагностированы ПГПТ, смешанная форма, новообразование левой нижней ОЩЖ, ХБП С3, мочекаменная болезнь, язвенная болезнь двенадцатиперстной кишки в фазе ремиссии, остеопороз смешанного генеза с потерей минеральной плотности костной ткани до -3,0 SD по Т-критерию в поясничном отделе позвоночнике. Пациентке было рекомендовано хирургическое лечение – удаление новообразования левой нижней ОЩЖ.

26.10.2017 г. проведена селективная паратиреоидэктомия. В ходе операции при ревизии обнаружено и удалено образование размерами 1,0×0,6×0,5 см. При гистологическом исследовании послеоперационного материала верифицирована аденома из главных клеток ОЩЖ.

Послеоперационный период протекал без особенностей. В поликлинике по месту жительства 03.04.2018 г. пациентке была выполнена внутривенная инфузия золедроновой кислоты 5,0 мг. При динамическом наблюдении через год, по данным DXA, отмечается выраженная положительная динамика в виде повышения минеральной плотности костной ткани в поясничном отделе позвоночника (LI–LIV) до -2,0 SD по Т-критерию. По результатам лабораторных исследований наблюдается нормокальциемия, нормофосфатемия (табл. 4). Достижение ремиссии заболевания после хирургического лечения также имело положительное влияние на СКФ, которая увеличилась с 58 до 73 мл/мин/1,73 м2.

 

Таблица 4. Показатели фосфорно-кальциевого обмена после проведенного хирургического вмешательства от 20.02.2019 г.

Параметр

Значение

Референсный интервал

Кальций общий, ммоль/л

2,33

2,20–2,55

Альбумин, г/л

46

35–52

Кальций, скорректированный на альбумин, ммоль/л

2,21

 

Фосфор, ммоль/л

1,09

0,74–1,52

Паратгормон интактный, пмоль/л

6,18

1,6–6,9

Креатинин, мкмоль/л

75

50–98

Скорость клубочковой фильтрации (СКФ), мл/мин/1,73 м2

73

90–120

Кальций, суточная экскреция, ммоль/сут

7,47

2,50–7,50

 

Несмотря на отсутствие данных за рецидив заболевания, сохраняются жалобы на тупую боль в правой поясничной области. По данным УЗИ вновь выявлены камни в почках.

В настоящее время пациентка получает терапию нативным витамином D (колекальциферол 10 000 МЕ/нед). Рекомендовано достаточное потребление кальция с продуктами питания, динамическое наблюдение эндокринолога и уролога.

ОБСУЖДЕНИЕ

ПГПТ почти всегда является доброкачественным состоянием автономной активности ОЩЖ. Примерно в 80–85% случаев обнаруживается солитарная аденома одной из желез [2], в остальных, как правило, встречается диффузная гиперплазия и гиперфункция всех четырех ОЩЖ [3, 4], в том числе в рамках наследственных синдромов – синдрома множественных эндокринных неоплазий (МЭН 1, МЭН 2А, МЭН 4), синдрома гиперпаратиреоза с опухолью челюсти (hyperparathyroidism-jaw tumour syndrome, HPT-JT), семейной гипокальциурической гиперкальциемии (familial hypocalciuric syndrome, FHH), семейного изолированного гиперпаратиреоза (familial isolated hyperparathyroidism, FIHP) [5].

Гиперкальциемия – один из основных биохимических маркеров ПГПТ. В норме повышенное содержание кальция в крови улавливается кальций-чувствительными рецепторами, в результате чего подавляется секреция ПТГ, снижается всасывание кальция из ЖКТ, повышается его экскреция почками, усиливается минерализация костной ткани. Автономное избыточное образование ПТГ влечет за собой повышение концентрации кальция в сыворотке крови. По различным международным данным, частота встречаемости ПГПТ составляет 0,5–21 случая на 1000 населения [6]. Данные о распространенности ПГПТ с нормальным уровнем ПТГ варьируют от 5 до 20%. Mischis-Troussard C. и соавт. [7] провели оценку частоты встречаемости подобного феномена среди 271 пациента, прооперированного по поводу ПГПТ. В предоперационном периоде иПТГ в пределах референсных значений был выявлен у 20 пациентов (7,4%). Наиболее часто предъявлялись жалобы на быструю утомляемость (n=13), полиурию (n=6), артериальную гипертензию (n=5), у пятерых из 20 пациентов при УЗИ были диагностированы камни в почках. В российской научной литературе нет сведений о частоте встречаемости сочетания гиперкальциемии с нормальной секрецией иПТГ.

Pang C. и соавт. [8] в июле 2018 г. опубликовали описание похожего клинического случая. 54-летняя женщина с сахарным диабетом 2 типа, гиперкальциемией на протяжении двух лет (кальций общий 2,51–3,03 ммоль/л), пептической язвой желудка, сердечно-сосудистыми нарушениями, жалобами на общую слабость была госпитализирована с подозрением на ПГПТ. По результатам обследования подтверждена стойкая гиперкальциемия, однако повышение уровня ПТГ не было выявлено (ПТГ 21,95 пг/мл (норма 15–65 пг/мл)). Сцинтиграфия с 99mTс-MIBI в сочетании с ОФЭКТ позволила обнаружить очаг патологической гиперфиксации радиофармпрепарата правой верхней ОЩЖ. После проведенного хирургического лечения и гистологически подтвержденной аденомы ОЩЖ уровень кальция снизился до нормальных значений (2,34 ммоль/л), концентрация ПТГ составила 16,51 нг/мл.

Еще один подобный случай описан в педиатрической практике Benaderet A.D. и соавт. [9] у 14-летней девочки, страдавшей панкреатитом, нефролитиазом, тяжелой гиперкальциемией (уровень кальция в диапазоне 3,3–4,4 ммоль/л), но с низким уровнем интактного ПТГ. По данным УЗИ ОЩЖ – эхографические признаки объемного образования левой верхней ОЩЖ размером 1,1×0,8 см. Последующая сцинтиграфия с 99mTс-MIBI показала увеличение поглощения радиофармпрепарата левой верхней ОЩЖ, что соответствовало данным УЗИ. Дооперационные показатели иПТГ, определяемые методом иммуноферментного анализа (ИФА), были низкими даже после серийных разведений, тогда как интраоперационное экспресс-определение уровня иПТГ выявило его повышение до 3618 пг/мл. Маленькой пациентке провели анализ последовательности гена ПТГ с целью выявления возможной экспрессии аберрантной молекулы ПТГ, не обнаруживаемой рутинным анализом. Геномная ДНК была выделена из дезоксирибонуклеиновой кислоты (ДНК) паратиромы и лейкоцитов периферической крови и амплифицирована с помощью полимеразной цепной реакции (ПЦР) с праймером в интроне 1 (5’–CATTCTGTGTACTATAGTTTG–3’) и обратным праймером в интроне 3 (5’–GAGCTTTGAATTAGCAGCATG–3’). Выявлена «молчащая» мутация в кодоне 83, кодирующем аргинин, что является распространенным генетическим полиморфизмом и не влияет на аминокислотную последовательность белка.

ПТГ синтезируется в ОЩЖ в виде молекулы-предшественника – пре-про-ПТГ, содержащей 115 аминокислотных остатков. В процессе переноса в эндоплазматический ретикулум отщепляется сигнальный пептид из 25 аминокислот от аминотерминального конца. Образующийся про-ПТГ транспортируется в аппарат Гольджи, где происходит ферментативное отщепление 6 аминокислот от аминотерминального конца про-ПТГ и образуется зрелый ПТГ, включающий 84 аминокислотных остатка (ПТГ 1-84) [10]. Известно, что кальций воздействует на процессы синтеза и секреции ПТГ через CaSR, а также влияет на стабильность мРНК пре-про-ПТГ [11, 12]. Учитывая отсутствие изменений в последовательности гена ПТГ, можно предположить о посттрансляционных изменениях молекулы ПТГ в нашем и вышеописанном клинических случаях, которые не могут быть распознаны только секвенированием ДНК.

На сегодняшний день большинство используемых методов определения ПТГ направлено на интактную молекулу (ПТГ 1-84). Применяемые иммунорадиометрический и иммунохемилюминесцентный анализы с антителами к N- и С-концам молекулы позволяют определить концентрацию иПТГ. Метаболизм ПТГ 1–84 происходит в печени (60–70%) с расщеплением между 33 и 36 аминокислотами и образованием биологически активных N-терминальных фрагментов (первые 34 аминокислоты). Однако в идеале специфичному лабораторному анализу должна подвергаться целая молекула ПТГ 1–84.

Принимая во внимание многообразие проявлений клинической картины ПГПТ, актуальной остается проблема ранней диагностики и своевременного лечения подобных больных. Выявленные при целенаправленном исследовании гиперкальциемия и незначительно повышенный иПТГ у пациентки с рецидивирующим течением мочекаменной болезни, выраженным снижением минеральной плотности костной ткани по данным DXA, язвенной болезнью в анамнезе позволили заподозрить ПГПТ. В то же время значительное снижение массы тела, повышение уровня СОЭ потребовали дополнительного диагностического поиска для исключения паранеопластического процесса, несмотря на отсутствие подавления ПТГ. Окончательный диагноз должен основываться на совокупности не только лабораторных данных, но и клинических признаков с учетом сопутствующих патологий и выраженности клинических проявлений гиперкальциемии.

ЗАКЛЮЧЕНИЕ

Представленный клинический случай демонстрирует важность исключения ПГПТ как причины рецидивирующего нефролитиаза и нефрокальциноза. Определение общего кальция, альбумина, сывороточного уровня ПТГ у больных, имеющих клиническую картину ПГПТ, позволит своевременно диагностировать заболевание и значительно улучшить качество жизни пациентов.

ДОПОЛНИТЕЛЬНАЯ ИНФОРМАЦИЯ

Источник финансирования. Подготовка и публикация рукописи проведены на личные средства авторского коллектива.

Конфликт интересов. Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Участие авторов. Все авторы внесли значимый вклад в проведение исследования и подготовку статьи, прочли и одобрили финальную версию статьи перед публикацией.

Согласие пациента. Пациентка добровольно подписала информированное согласие на публикацию персональной медицинской информации в обезличенной форме в журнале «Ожирение и метаболизм».

Olga O. Golounina

I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)

Author for correspondence.
Email: olga.golounina@mail.ru
ORCID iD: 0000-0003-2320-1051
SPIN-code: 7793-2123

Russian Federation, 8-2, Trubetskaya street, Moscow, 119992

Student, Medical faculty

Gyuzel E. Runova

I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)

Email: guzelvolkova@yandex.ru
ORCID iD: 0000-0003-2144-8595
SPIN-code: 3639-6932

Russian Federation, 8-2, Trubetskaya street, Moscow, 119992

MD, PhD

Valentin V. Fadeyev

I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)

Email: walfad@mail.ru
ORCID iD: 0000-0002-3026-6315
SPIN-code: 6825-8417

Russian Federation, 8-2, Trubetskaya street, Moscow, 119992

MD, PhD, Professor, Corresponding member of the RAS

Anna S. Pogorelova

I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)

Email: avolijovon2004@mail.ru
ORCID iD: 0000-0002-8433-4432
SPIN-code: 6430-3003

Russian Federation, 8-2, Trubetskaya street, Moscow, 119992

MD, PhD

Gilyana V. Boldyreva

I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)

Email: boldyreva_g@mail.ru
ORCID iD: 0000-0002-8897-9924
SPIN-code: 4518-1679

Russian Federation, 8-2, Trubetskaya street, Moscow, 119992

MD, resident

  1. Мокрышева Н.Г., Рожинская Л.Я., Кузнецов Н.С., и др. Клинические рекомендации Первичный гиперпаратиреоз: клиника, диагностика, дифференциальная диагностика, методы лечения // Проблемы эндокринологии. – 2016. – Т. 62. – №6. – С. 40-77. [Dedov II, Melnichenko GA, Mokrysheva NG, et al. Primary hyperparathyroidism: the clinical picture, diagnostics, differential diagnostics, and methods of treatment. Problems of Endocrinology. 2017;62(6):40-77. (In Russ).] doi: https://doi.org/10.14341/probl201662640-77
  2. Bilezikian JP. Primary Hyperparathyroidism. J Clin Endocrinol Metab. 2018;103(11):3993-4004. doi: https://doi.org/10.1210/jc.2018-01225
  3. Bilezikian JP, Bandeira L, Khan A, Cusano NE. Hyperparathyroidism. Lancet. 2018;391(10116):168-178. doi: https://doi.org/10.1016/S0140-6736(17)31430-7
  4. Bilezikian JP, Cusano NE, Khan AA, et al. Primary hyperparathyroidism. Nat Rev Dis Prim. 2016;2(1):16033. doi: https://doi.org/10.1038/nrdp.2016.33
  5. Thakker R V. Genetics of parathyroid tumours. J Intern Med. 2016;280(6):574-583. doi: https://doi.org/10.1111/joim.12523
  6. Adami S, Marcocci C, Gatti D. Epidemiology of primary hyperparathyroidism in Europe. J Bone Miner Res. 2002;17 Suppl 2(6):N18-23. PMID: 12412773
  7. Mischis-Troussard C. Primary hyperparathyroidism with normal serum intact parathyroid hormone levels. QJM. 2000;93(6):365-367. doi: https://doi.org/10.1093/qjmed/93.6.365
  8. Pang C, Fan Y, Zhang H, et al. Case report: incidental parathyroid adenoma in a Chinese diabetic patient with hypercalcemia and normal parathyroid hormone levels. Medicine (Baltimore). 2018;97(28):e11333. doi: https://doi.org/10.1097/MD.0000000000011333
  9. Benaderet AD, Burton AM, Clifton-Bligh R, Ashraf AP. Primary Hyperparathyroidism with Low Intact PTH Levels in a 14-Year-Old Girl. J Clin Endocrinol Metab. 2011;96(8):2325-2329. doi: https://doi.org/10.1210/jc.2011-0247
  10. Goltzman D. Physiology of Parathyroid Hormone. Endocrinol Metab Clin North Am. 2018;47(4):743-758. doi: https://doi.org/10.1016/j.ecl.2018.07.003
  11. Brown EM. Physiology and pathophysiology of the extracellular calcium-sensing receptor. Am J Med. 1999;106(2):238-253. doi: https://doi.org/10.1016/S0002-9343(98)00418-5
  12. Moallem E, Kilav R, Silver J, Naveh-Many T. RNA-Protein Binding and Post-transcriptional Regulation of Parathyroid Hormone Gene Expression by Calcium and Phosphate. J Biol Chem. 1998;273(9):5253-5259. doi: https://doi.org/10.1074/jbc.273.9.5253

Supplementary files

There are no supplementary files to display.

Views

Abstract - 202

PDF (Russian) - 132

Cited-By


Dimensions


Copyright (c) 2019 Golounina O.O., Runova G.E., Fadeyev V.V., Pogorelova A.S., Boldyreva G.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies